Hobbies: Park protests, building an army to overthrow the govt & killing time at the police precinct. Unmarried, unwoke & unjabbed - I guess I'm not a joiner.
Merry Xmas to all the
#COVID19
trolls & hostile within govt nudgers that tried to debunk me as a stupid anti-vax conspiracy theorist for calling out this hoax since Jan 2020.
Here's my psych test & licence to say FU block heads. I am the real "expert" in the room lol.
@GetSchwifyinere
You're a liar. I'm a wheely & went to the 2x Aussie hospitals to check them out before Covid hitting. The carparks were empty. The photo below is in the middle of the wave after hrs. Daytime patrolled by guards for a show but COVID19 goes away at night lol.
#NoAmnesty
@villagerssn
@Jikkyleaks
@profnfenton
@thecoastguy
@ToniaBuxton
Cass Sunstein who co wrote the Nudge book was administrator of White House Office of Info & Regulatory Affairs. His Mrs is Samantha Power USAID that suspiciously financed Wuhan labs. Both were Obama appointees. Sunstein worked with BIT UK.
@HaFuChalice
@MurrayWatt
I see people are starting to get the drift. It is yet another misinformation bluff from a bunch of corrupt WEF neoNazi thieves & traitors
@ausvstheagenda
Yes I'll be lodging to that inquiry if it ever gets up showing that
@AustralianLabor
has misappropriated public money without the Constitutional power to do so, Futher that they should be referred to NACC for harm already done.
@DrSusanOliver1
You're nothing but a despicable lowlife liar. I've never seen a single video where Campbell asked for $$ for himself & always puts references in comments. Covid19 was an overblown hoax
& you're going to go to jail. We won't stop & know what you did.
.
@IanCopeland5
@FiveTimesAugust
@thevivafrei
Aussie Freedom Fighter & Still Waiting!
I can prove COVID-19 was an overblown hoax from 23 Jan 2020.
There was no case for Emergency Authorization of COVID-19 rebranded listed poison inoculations.
#NoAmnesty
.
@cultured_spice
@seadogsimi69
Confirmed
@Jikkyleaks
#mutton
are using Kirsch as a go between. Second coordinated attack with the same sh*t responses. They must be really frightened about my data proving it was a hoax from 23Jan2020. Curdled Spice is putting out bait comments which is incitement.
@Jikkyleaks
@carl_jurassic
@WaterPusherr
@Kevin_McKernan
Jan 2020 there was another guy that was hassling me "Chris". He was definitely on the inside. We were all getting our numbers info from WHO situation & other bots from China News reports but "Chris" was quoting Bloomberg rag that was ahead of even WHO numbers. WHO later added...
@Jikkyleaks
I'm sure this will give you a laugh. My submit to Aussie's rigged PM's C19 inquiry is censored but accepted public. The inquiry's given it submission no. "1984" lol. Links to other past submits are within it at the bottom.
@threedogsonekid
@Jikkyleaks
Amazing isn't it. They won't give a transplant to the unvaccinated but it's AOK to give transplants to medical experiment participants. No discrimination there at all 🙄 A big thanks to Lainie Friedman Ross for arguing this so elequently
Hey
@Jikkyleaks
& Jikkyteers what does anyone know about UNSW Dr Susan Oliver cause I'd put money on her troll protector squad having access to all Aussies health data & breaching peoples medical privacy.
@norman_pilon
remember when my tweet about throwing out a bit of burley
@Jikkyleaks
@DrWoofAus
@WaterPusherr
@Kevin_McKernan
Hmmm I wonder how that would go with precedents on unlawful tresspass. They got no permission to park their DNA rubbish in peoples property aka their bodies. Could an order be obtained to demand full removal or charge a fee for rental?
@Jikkyleaks
@SageListener
@RandPaul
Deliberate!
1. By Covid19 deceased 29 Feb 2020 it didn't even spread in China (WHOs situation reports shows 96% still in Hubei). So why did WHO call a pandemic at all?
2. If the strain is real & the 16K deaths were down to the China NOVEL C19 without comorbidities& not over...
@GetSchwifyinere
Just put music & a few more shots of dancing feet to it & you've got it right. We all saw those videos think we will ever forget. The pic below an 80yo who sat in an almost empty emergency ward for 2days with no treatment
#NoAmnesty
@cultured_spice
@seadogsimi69
@Jikkyleaks
You incited the response when poked fun at someone losing their job. My response was measured with equal force to defend them. You then coordinated a psychological bullying assault with multiple hostile entities & that was not equally measured force or in defence but an offence.
@NickHudsonCT
With respect WHO also changed the definition of good ole flu in 2018. This was a preplanned measure that saw pneumonia being removed from the influenza statistics. Had that not been done COVID19 would have been seen to not have been as deadly as influenza when they did ...
@CKellyUAP
Inman had the info showed Aussie elections being played before Twitter Files. With her Twitter history had to know my conclusions were right. Shouldn't just be sacked but subject to Crimes Act misusing info to push on with a censorship agenda for WEF
@gorskon
No actually you don't. If you were a surgeon then you'd know you need qualifications in virology, immunology or possibly pathology to make that call. So now we've established you're a liar. The Covid jabs are not a vaccine. They are a poorly tested gene therapy & listed poison...
@i_iratus
@CartlandDavid
You're a murderer, liar & a disgrace to medicine. It was a hoax all along the dates don't lie. Millions hurt just by side effects alone that everyone knew would happen. You lied to everyone "Safe & effective" is rubbish.
We see you & we are coming!
@CKellyUAP
First trials healthy 18-55yo's & by big pharma's data showed a 5-10% fail in the short trial period. Most get colds 2-3 times a yr so acquired natural immunity 4-6mths. The knew it would fail & rolled it out always intending to boost every 4mths....
@JacquiDeevoy1
Don't! It is a harmful & dangerous direction. Australia effectively had a trial of cashless with Cashless Welfare Card. It was a disaster with birthweight of babies reduced in the areas where it was introduced. Senate stopped it after a 6 yr trial .
@Jikkyleaks
1. Love bots 2. Im dying what are you selling. 3. Fishing for quals. 4. Assigning you a new best friend. 5. Inflating your follower no.s. 6. Using the bulk replies to keep you busy from putting out your own material. 7. Using the new followers interactions to your tweets to...
@SenatorRennick
Cause Doherty's who gave PCRs Aussies gold kudos were interpreting positives the exact opposite to WHO recomends. Positive results from the flawed process enabled access to private med files they wouldn't normally get. Then WHO's settings were also too high & adjisted end of 2020
@SenatorRennick
You'd have to wonder about how "Smart" the Energy Council is when they hired someone bought by Adani to lie about their fully automatic pit to port coal mine?
@DrSusanOliver1
1of feed Let me help u with that
@VaccineMole
cause it seems she's sneaky & deceptive as well as being an utter b*tch. UNSW was in a secret p/ship with Uni of Syd supported by NSW govt. COVID19 hoax that resulted in the fraudulent acquisition of public...
@PRGuy17
Her WEF poster is all I need to know.
s44(i) Wong is under "acknowledgement" from a foreign power.
WEF has clearly stated it has infiltrated the govts.
The traitor should be referred & go immediately.
@TrialsiteN
Is that because we caught them out having colluded to conserve a gene sequence between all the companies that just happened to have a PAM sequence?
Bookmark this sequence
👇👇👇👇👇👇👇
ATCGCCGACTACAACTACAAGCTGCCCGACGACTTCACCGG
#CRISPRgate
@JesslovesMJK
@AdhesionsOrg
@CraigKellyPHON
They published my submission & redacted screen shots of who started toiletpapergate, the name of the nudge king & his Mrs behind the brainwashing & slapped the submission no. 1984 on it. The entire panel & Albanese who set it up are a disgrace.
The latest
@Jikkyleaks
. The lowlife scum are getting people to open up about vax injured people they know then attacking responders with hate speech to stop people talking about vax injuries. I'm waiting for a response to mine. You just had to know
@DrJanKirsch
would be involved
@AnnadeBuisseret
Public Health did not just encourage & push the use of a medical intervention they knew did not work but one they knew was harmful & potentially facially disfiguring even if changed regularly.
Sutherland author of article 20/5/2020 defending actions of UK's Behavioural Insights Team nudgers part of SAGE who admitted exaggerated Covid19 beyond the reality ()
Now gives free courses
@Jikkyleaks
on how to nudge.
Priceless!
()
@RESPECT_OZ
Take a good look at this map. HMAS Toowoomba was allegedly in the Yellow Sea. If someone drove a warship unannounced onto our Sydney Harbour what would we do. I think a lot of questions should be asked who authorised this
@Jikkyleaks
@jcf527
@projecthalo
1of feed - And involved with Robodebt. They had an AI process that speeded up the processing of the illegal debts. Capgemini is not an accounting firm. Whoever did the indie auditing of that system was totally corrupt. Melissa Golightly was a published...
@TheLancet
What you mean to say is the Lancet apologises for being a key tool of misinfo for neoNazi WEF behavioural nudgers. That it apologises for being an echo for big pharma genetics research & was complicit in billions globally being fraudulently conned into being crash test bunnies.
@CraigKellyPHON
There is no doubt Dutton was 100% in on Covid hoax. He is not above the law. As Minister with control of the borders he was instrumental in the decision to close them unnecessarily on 20 March that was a media smoke screen to cover Dept of Social Security changes Labor was...
@senatorbabet
I voted Exit.
1. I'd consider staying in UN long enough for ICC to hear Nuremberg2. If they don't & try to cover up for WEF/WHO then I'd leave.
2. Both WEF/WHO acted outside of the purpose UN was set up (counter the rise of fascism). I'd leave now & demand all money pd back.
@CKellyUAP
When Covid started vulnerable were deemed in Qld to be nonessential. Ordered to lockdown. We were virtually starved in our homes with no support or regular food deliveries & what was delivered was not fresh food & top dollar. We were given times we were allowed to actually go..
@Jikkyleaks
tag team try to dissuade your direction. Incl fast follower drops. 8. Continual baiting & insulting. 9. Reporting en mass when you retaliate to get you suspended......On my third account & same pattern last two.
@cultured_spice
What an utter b*tch & emotional dweeb you are . Rejoicing at someone losing their job for standing up for human rights principles. Here live it up you piece of sh*t & enjoy the damage you've done to babies.
#NoAmnesty
@CKellyUAP
No wonder she's went straight the censor capital community to work. With millions awake now there's Buckley's chance of a crimes against humanity nudge rebrand but still they try. I bet they've had the shock of their lives no-one is letting it drop this time.
@CKellyUAP
Exactly. Why are Aussies AFP Home Affairs etc trained by foreigners. Right from the start they are peer pressured by foreign interests. Add the foreign nudgers operating in PM & Cabinet into that mix its no wonder they don't know who they serve.
@zalisteggall
You can shove your
#WEFpuppet
Misinfo or Disinfo by any other name bill where the sun don't shine. We all saw how the legislation was unfairly applied in Covid hoax. We all saw how UAP was ridiculously targeted for font size. How Labor's use of AEC colours was ignored in VoteYes.
@CKellyUAP
Exactly - Looks like rotten big pharma stacked TGA led the way to shut down all over counter cheap cold/flu treats ahead of hoax. Creating foreign monopoly & costing the pubic purse. Financially harmful for foreign interests!!!
@JEChalmers
@ConversationEDU
@michellegrattan
Just a reminder Tax is money we wouldn't have to pay at all if govts had managed the countries resources properly. For decades nothing but theft & greed by govts.
Now
@AustralianLabor
plans to sell us out to WHO & WEF.
Sack them all!
@lesstenny
He's lying. People had change details of National Welfare Fund referendum held 1944 were circulated in newspaper. You cannot just repeal Acts unless you can show they were not created in s51 "good order". The Voice may give the Committee the power to decide what is good/bad order
@VigilantFox
I'm not so sure it is safe. I researched the history of winter religious ceremonies because early churches had the hospitals attached. Wormwood is the key ingredient in Absinthe. It has a traditional nickname Green Fairy. It has a side-effects...
.
@CKellyUAP
I've been raising the temp issue to govt since I lodged to RC Feb2021. It was so critical for a lot of things I actually ended my submit with a second reminder about it. Is no way products could've been successfully carted across Australia without temp fluctuations. Even f&v...
@CKellyUAP
Australia was cut off from the rest of the world for Mileniums. Our people overcame desert survival uniquely by their own initiatives. Having a single controlling hand auto-feeding the world will not enable survival skill development for a real global disaster
@CKellyUAP
“The effects of vitamin D within the lungs include increased secretion of the antimicrobial peptide cathelicidin, decreased chemokine production, inhibition of dendritic cell activation and alteration of T cell activation. These cellular effects are important for host...
@unmasking_media
In Qld I was personally threatened by security staff of Clifford Gardens' Shopping Centre Toowoomba with a fine oif $20K for not social distancing in a food court. That neo Nazi Palaszczuk, Miles & D'Ath goes do you hear me
@QLDLabor
.
Non negotiable put Labor last!
@CKellyUAP
Qld Govt is still encouraging businesses to discriminate against the unvaccinated. When govt owned Qld Investment Corporation owns many of the shopping centres it has an unfair leverage on an ability for vaccinated to equally trade. I doubt this is constitutional.
@Jikkyleaks
Ha Ha Ha Sneaking my rejected anti-Covid data in as ref3 in an accepted public submission to Aussie Senate Inquiry Purpose, Intent & Adequacy of the Disability Pension. They were rejecting anything anti the rhetoric at that time.
@ausvstheagenda
Yes I'll be lodging to that inquiry if it ever gets up showing that
@AustralianLabor
has misappropriated public money without the Constitutional power to do so, Futher that they should be referred to NACC for harm already done.
@FranMooMoo
Repeat -There's NO authority within the Constitution for parliament to do anything digital. Entire funding of this Commission is misappropriation of public money. Digital was not patented till the 60's validating it was not like other technology in s51V
@MTWahrheit
@Jikkyleaks
@ABridgen
@Johnincarlisle
I think this may be a bigger global problem. F/book censored my circulation of a free St John's Ambulance DRABC resuscitation chart with a tip on detecting shallow breathing ambos gave me. That blanket extended a long way. I lodged my concerns in RC Disability update Feb2022....
One of the things drove me nuts I am an emergency expert.
Fully trained State warden/welfare ex dpty rescue ldr & accounting qualified to design forecast model & did.
When I insisted on giving right answers was SM censored at the behest it seems of Aussie govt as I was correct.
One of the things that really drove me nuts during the “pandemic” was when people would ask questions or want to discuss what was going on only to be told that they couldn’t because they weren’t experts.
Well, guess what?
You don’t need any degrees or credentials to understand
@CraigKellyPHON
There is no way with Duttons poor history on Covid19 & now censorships that Liberals will win an election with Dutton & Ley at the helm. Dutton's bout of Covid when it was downgraded March 2020 puts him in the frame. This has the feel of a Lipspill feeler & the timings ripe
@MurrayWatt
Hmmm. Parliament plans to tell "The Voice" what it can say & pick the Committee (so who can say it). The Voice therefore is replacing Aborigines story with Parliament's story while putting a big Build Language Back Better for WEF stamp on it.
#VoteNo
& tell Labor where to go!
@DrSusanOliver1
I'm not even going to bother looking at this research because if you're promoting it, it is probably bait. You are a nasty piece of work that has defamed many good health advocates to get attention for your own crooked evil ends. You are a disgrace to real science.
@JennyMi11374978
You've been lied to & played by
@AustralianLabor
. They started Robodebt with the Data Match Act 1990. They ramped up Robodebt digital under Plibersik & misled all Aussies about it working. It never worked & could never have worked for historical data matches. New Ombudsman's...
@FranMooMoo
Repeat -There's NO authority within the Constitution for parliament to do anything digital. Entire funding of this Commission is misappropriation of public money. Digital was not patented till the 60's validating it was not like other technology in s51V
@MTWahrheit
@zalisteggall
Shorten is a crook that was in on
#Robodebt
from the start. One off allowances on things like eg student start up allowances have been going to interim a/c's from Centrelink instead of direct to customers.
@AustralianLabor
rigged
#RobodebtRC
. My submission is still not published
@Jikkyleaks
@SageListener
@RandPaul
average mortality age then they would have had to have been purposefully infected & it is still murder. So why is no-one investigating it as murder?
3. Why did the media hype up the panic from 23 Jan 2020 when there were less than 30 deaths from an alleged coronavirus...
@catrollison
I was reconciled with aborigines long before the Voice. They are old friends, neighbours & workmates. I see though after the Basics Card & Labor getting all those donations off miner Twiggy why it feels the need to apologise.
Do it on your dime though not mine!
Put Labor Last!
@CKellyUAP
WHO showed in COVID19 that after receiving $B's they did not even have medical science & knowledge to basic first aider level. No first aider would ever recommend using a mask when vomiting was an alleged symptom. Airways clear is fundamental to oxygen intake & life.
Fraudsters!
@CazadorsCat
@GetSchwifyinere
It prevented nothing. There was no threat to start with. Even UK's health dept downgraded it as not a HCID Mar2020. It was never a superspreader & WHO committed fraud when they called it a pandemic.
@IanCopeland5
@FiveTimesAugust
@thevivafrei
Aussie Freedom Fighter & Still Waiting!
I can prove COVID-19 was an overblown hoax from 23 Jan 2020.
There was no case for Emergency Authorization of COVID-19 rebranded listed poison inoculations.
#NoAmnesty
.
Good on you Texas.
Aussie Freedom Fighter & we love how the dynamic duo Abbott & Paxton get things done.
Stand up Americans while you still have a country to stand up for.
We need are partner back not a whipped Biden dog.
#IStandWithTexas
@Jikkyleaks
@ScienceNvrSttld
Yep - Whistleblowers. Data I saw was non-identifying data. So why not in the public domain anyway? When I reconned Covid19 on the outside (ex trained emergency warden) I was horrified I had to rebuild historic data from news reports to get an annual flu benchmark. In a real...
@CraigKellyPHON
@eSafetyOffice
@tweetinjules
Reminder Twitter's a platform for over 13yo & Defence of Minimum Age of Criminality for eg Qld is 10 & way below Twitter's subscription age. If people are deemed fit to dissiminate legal unlawfullness at 10 then sure as eggs they can at 13. Her actions are not empowered as she...
your files if like me you did win a tribunal case just to namne a few disgraceful things. News on the telly & even in shopping centres were full of behavioural incite cruel messages enforcing the belief that people that got unlawful debts from Centrelink were really welfare ...
@carl_jurassic
@Jikkyleaks
@muttoncrewe
I luv u Jurassic. I thought the same lol. The BOTs are programmed to target keywords & respond. Its the achillies heel. It means you can expose them simply by fishing tactics of throwing a bit of burley & getting them excited enough to start a feeding frenzy where more of the...
@CKellyUAP
We were told public money was used to buy freezers. Where are they?
Lodged to RC Feb 2021 & the copy of the submission was sent to Senate Covid where it was also rejected by the Committee Secretary because it has been 100% correct.