Rise and fall of SARS-CoV-2 dynasties

Please update to V4.1 primers https://t.co/LNZfz5WPfe premixed are available from @idtdna and @merckgroup

This is the sort of evidence you want to see to be convinced you are dealing with a recombinant lineage:

🎄✨ 🎄✨ We have a Christmas riddle for you today! 🎄✨🎄✨ TGGCACGCCACCATCAGCAGCGCCAACACCGCCAGCAACATCAACACCCACAGGGAGATCAACGACGAGGAGAGGTGCGCCCTGCTGGAGGAC

Met the newest member of the family tonight 🐾

(And yes, I will be meeting her when I go home this week!)

After losing my beloved cocker spaniel, Jem earlier this year, I am delighted to say that my parents decided to bring home another cocker spaniel yesterday. Meet Lily!

Extremely insightful talk so far on intersectionality and what needs to change to improve diversity and prospects in science

Please share: We are aware of an email circulating saying we are offering walk ins for booster vaccinations. Please note this is not true. All eligible adults will receive an appointment directly. Please do not attend for your booster until we have contacted you. Thank you

Public health agencies remain essential COG-UK partners, ensuring patient benefit and the integration of #SARSCOV2 genomic sequencing in diagnostic strategies🩺 ... 2/7 @UKHSA @P_H_S_Official @publichealthni @PublicHealthW

Thought this looked familiar #SpotifyWrapped #bioinformatics

keep calm and carry (omicr)on

(why did this have to autocorrect)

I don’t even consider myself a Taylor Swift superfan (though I do enjoy bits of her music), I’m just doing this to show that I can

The power I draw behind doing stereotypically feminine things in a male-denominated field is both unprecedented and unnecessary (some would argue it’s “procrastination” — to that I say *poppycock*)